Journal: BMC Gastroenterology

Article Title: Role of tight junction proteins in gastroesophageal reflux disease

doi: 10.1186/1471-230X-12-128

Figure Lengend Snippet: Characteristics of primers, RT-PCR protocol and antibodies

Article Snippet: ZO-2 , fw: AGAGGACACGCCGAGCAGATTG rv: TCCCGACATCATTGCCACCAG 272 bp, 60°C , polyclonal rabbit anti-ZO-2 antibody No. 71–1400, (Invitrogen, Carlsbad, CA, USA, EDTA retrieval, Final dilution: 1:150.

Techniques: Sequencing

Journal: Journal of Molecular Medicine (Berlin, Germany)

Article Title: Acid sphingomyelinase inhibition protects mice from lung edema and lethal Staphylococcus aureus sepsis

doi: 10.1007/s00109-014-1246-y

Figure Lengend Snippet: Endothelial cells were infected for 2 h with S. aureus (MOI 10:1) or left uninfected. As indicated, cells were pretreated for 20 min with amitriptyline (Ami) (20 μM), Tiron (10 mM), or NAC (10 mM) before infection with S. aureus . Immunofluorescence stainings were performed with antibodies against ZO1, ZO2, occludin, or E-cadherin for determination of the degradation of these TJ proteins. The presented pictures are representative of the results of at least three independent experiments. Scale bar is 25 μm

Article Snippet: Samples were washed and incubated overnight at 4 °C with antibodies against ZO1 (Invitrogen 40-2300, rabbit IgG), ZO2 (Santa Cruz Biotechnology Inc. sc-11448, rabbit IgG), occludin (71-1500, rabbit IgG, Invitrogen), or E-cadherin (Santa Cruz Biotechnology Inc. sc-7870, rabbit IgG).

Techniques: Infection, Immunofluorescence

Journal: Journal of molecular medicine (Berlin, Germany)

Article Title: Acid sphingomyelinase inhibition protects mice from lung edema and lethal Staphylococcus aureus sepsis.

doi: 10.1007/s00109-014-1246-y

Figure Lengend Snippet: Fig. 4 Endothelial cells were infected for 2 h with S. aureus (MOI 10:1) or left uninfected. As indicated, cells were pretreated for 20 min with amitriptyline (Ami) (20 μM), Tiron (10 mM), or NAC (10 mM) before infection with S. aureus. Immunofluores- cence stainings were performed with antibodies against ZO1, ZO2, occludin, or E-cadherin for determination of the degradation of these TJ proteins. The present- ed pictures are representative of the results of at least three inde- pendent experiments. Scale bar is 25 μm

Article Snippet: Samples were washed and incubated overnight at 4 °C with antibodies against ZO1 (Invitrogen 40-2300, rabbit IgG), ZO2 (Santa Cruz Biotechnology Inc. sc-11448, rabbit IgG), occludin (71-1500, rabbit IgG, Invitrogen), or E-cadherin (Santa Cruz Biotechnology Inc. sc-7870, rabbit IgG).

Techniques: Infection

Journal: The Journal of Clinical Investigation

Article Title: Astrocytic tight junctions control inflammatory CNS lesion pathogenesis

doi: 10.1172/JCI91301

Figure Lengend Snippet: (A–C) Immunoprecipitation of cell lysates from cultured human astrocytes under control and IL-1β–treated conditions reveals that CLDN4 and JAM-A bind different patterns of intracellular TJ adaptor proteins. (A) Cell lysate inputs confirm that astrocytes upregulate JAM-A and CLDN4 after IL-1β treatment and express a variety of intracellular TJ adaptor proteins at baseline and under IL-1β–treated conditions. (B) CLDN4 associates with cingulin, CASK, ZO-1 (the latter weakly), and β-actin. (C) JAM-A complexes with an overlapping but slightly different array of TJ-associated proteins, including ZO-1, ZO-2, afadin, and cingulin (the latter weakly). Interestingly, and compatible with previous reports (30), CLDN4 and JAM-A do not coimmunoprecipitate with each other, suggesting that the 2 proteins do not associate directly and, if connected at all, are linked via weaker bonds of intermediary proteins. (D) Nonspecific isotype control mouse IgG1 and polyclonal rabbit IgG do not show signal at the molecular weights corresponding to TJ-associated proteins of interest, confirming that antibodies for TJ adaptor proteins are specific. Data are representative of findings from more than 3 biological replicates (A–D).

Article Snippet: Anti–ZO-1 (617300, rabbit) was from Life Technologies, and anti–ZO-2 (rabbit) was from Zymed.

Techniques: Immunoprecipitation, Cell Culture